high-throughput sequencing Whole-Genome-Sequence-for-Cancer

W HOLE G ENOME S EQUENCING FOR C ANCER                                                                                                                                                                                                                     ­                            €                                                                                              ‚                            ƒ                                                                                                 ­                                                                                       „ …                                                     †                                                              „                ‡                                                                                                  ˆ ‚€   ‚ ‰ ‚  ‰                           ­                  †                Š … ‹                                  Œ        Ž ‘  ‹                    ’                                          ‰         ‹              Creative Biolabs Whole Genome Sequencing Service for Cancer 1 WGS WorkFlow        ­  † ‡­ CGTATCTAGGTACCCACGGACGATA CGTATCTAGGTACACACGGACGATA ATAGTCGTATCTAAGTACC ATAGTCGTATCTAAGTACCCACGG ATAGTCGTATCTAAGTACCCACGGATGATA       ATAGTCGTATCTAAGTACCCACGGATGATAGCTTACG CTAAGTACCCACGGATGATAGCTTACGCTA TACCCACGGATGATAGCTTACGCTAAC € „…  €   ‚    ƒ   2                Applications                                     W HAT WE DO : F EATURES : Whole Exome Sequencing (WES) Service Target Sequencing Service Whole Transcriptome Sequencing (WTS) Service Immune Repertoire Sequencing Service © 2007 - 2019 Creative-Biolabs All Rights Reserved Up to 99.99% Accuracy Identify Potential Causative Variants Detect DNA Modifications without Bisulfite Treatment Identify Large Structural Variants Phase Alleles and Ariants Email: info@creative-biolabs.com Tel: 1-631-381-2994