Acta Dermato-Venereologica issue 50:1 98-1CompleteContent | страница 41
146
SHORT COMMUNICATION
Predominant Contribution of CD4 T Cells to Human Herpesvirus 6 (HHV-6) Load in the Peripheral
Blood of Patients with Drug-induced Hypersensitivity Syndrome and Persistent HHV-6 Infection
Fumi MIYAGAWA, Yuki NAKAMURA, Rie OMMORI, Kazuya MIYASHITA, Hiroshi IIOKA, Natsuki MIYASHITA, Mitsuko
NISHIKAWA, Yukiko HIMURO, Kohei OGAWA and Hideo ASADA*
Department of Dermatology, Nara Medical University School of Medicine, 840 Shijo, Kashihara, Nara 634-8522, Japan. *E-mail: asadah@
naramed-u.ac.jp
Accepted Sep 13, 2017; Epub ahead of print Sep 13, 2017
Drug-induced hypersensitivity syndrome (DIHS)/drug
reaction with eosinophilia and systemic symptoms
(DRESS) is a severe adverse cutaneous drug reaction
associated with the reactivation of human herpesvirus 6
(HHV-6). In DIHS, HHV-6 is generally reactivated 2–3
weeks after the onset of a rash, and such reactivation is
associated with the flare-up of clinical symptoms (1).
The reactivation of HHV-6 usually occurs as a transient
event; however, in rare cases HHV-6 DNA continues to
be detected long after the onset of the condition, which is
sometimes associated with frequent recurrence of clinical
symptoms, such as skin rashes. There has been only one
report of a case of DIHS involving a persistent HHV-6
infection (2). We report here 3 cases of DIHS in which
HHV-6 DNA was detected in the patients’ peripheral
blood mononuclear cells (PBMC) long after resolution
of their DIHS. We also demonstrated that CD4 T cells
were the main contributors to the PBMC HHV-6 DNA
load throughout the patients’ clinical courses, while in
the early stages of their conditions CD14 + monocytes
and other types of PBMC also harboured HHV-6 DNA.
PATIENTS AND METHODS
The characteristics of the 3 patients with DIHS are listed in Table
SI 1 . Blood samples were obtained from each patient after the
onset of a rash. PBMC were isolated from whole blood by Ficoll
gradient separation (GE Healthcare, Little Chalfont, UK) and
divided into 2–3 aliquots. Sera were separated from whole blood
by centrifugation. An aliquot of PBMC and an aliquot of serum
were subjected to real-time polymerase chain reaction (PCR)
to detect and quantify HHV-6 DNA. Briefly, DNA was isolated
from PBMC or serum using the QIAamp DNA blood mini kit
(QIAGEN, Hilden, Germany), according to the manufacturer’s
protocol. Real-time PCR was performed with the TaqMan fast
advanced master mix (Applied Biosystems, Foster City, CA,
USA) and the following primers and probe (3): forward primer:
GAAGCAGCAATCGCAACACA, probe: AACCCGTGCGCCG-
CTCCC, reverse primer: ACAACATGTAACTCGGTGTACGGT.
The PCR and data collection were conducted on an Applied
Biosystems StepOnePlus real-time PCR system. A further aliquot
of PBMC was subjected to magnetic bead purification (Miltenyi
Biotec, Bergisch Gladbach, Germany) to obtain CD14 + cells.
The rest of the cell fraction was subsequently used to purify the
CD4 T-cell fraction. The HHV-6 DNA load of each cell type was
then measured by real-time PCR. In some experiments, a further
aliquot of PBMC was subjected to CD16 + cell isolation followed
by CD8 T-cell isolation using magnetic beads. To detect the
https://www.medicaljournals.se/acta/content/abstract/10.2340/00015555-2791
1
doi: 10.2340/00015555-2791
Acta Derm Venereol 2018; 98: 146–148
U31, U39, U90, and U94 gene transcripts, purified CD4 T cells
from PBMC were cultured with 5 µg/ml phytohaemagglutinin
(PHA) and 20 units/ml recombinant human interleukin 2 in GIT
medium (WAKO, Tokyo, Japan). Seven days later, the cells were
harvested and subjected to RNA extraction using an RNeasy plus
kit (QIAGEN) followed by cDNA synthesis using a high-capacity
RNA-to-cDNA kit (Applied Biosystems). Real-time PCR was
carried out using specific primers and probes.
RESULTS AND DISCUSSION
As shown in Fig. 1A, HHV-6 DNA was detected at re-
latively high copy numbers long after resolution of the
patients’ DIHS, although the amounts of DNA detected
at these time-points were lower than those seen during
the early phase of the condition, except in case 3, in
which HHV-6 DNA was detected on the day of admis-
sion (day 8).
Since little is known about which types of PBMC
harbour HHV-6 in DIHS patients with persistent HHV-
6 infections, we next evaluated the HHV-6 DNA loads
of CD4 T cells, CD14 + cells, and the remaining PBMC
obtained from the 3 patients. During the early phase of
the patients’ DIHS, HHV-6 DNA was detected in all cell
types, with CD4 T cells being the predominant cell type.
At later time-points, CD4 T cells seemed to harbour the
majority of the HHV-6 DNA load (Fig. 1B).
HHV-6 was found to mainly infect and replicate in
CD4 T cells. However, HHV-6 is able to infect a wide
variety of cell types, including natural killer cells and
dendritic cells (4). In the latent state, HHV-6 is reported
to persist in monocytes/macrophages (4). In some ca-
ses, HHV-6 DNA could not be detected in PBMC from
healthy individuals with latent HHV-6 infections (4),
whereas in others low levels of HHV-6 DNA (around 2
log10 copies/ml) were detected (5, 6).
In our study, no HHV-6 DNA was detected in the
patients’ sera at later time-points (Fig. 1A), and while
the patients’ anti-HHV-6 IgG titres increased during the
early stages of their conditions they subsequently star-
ted to decline (Table SI 1 ), which is not consistent with
reactivation. These findings suggest that latent HHV-6
persisted in the patients’ CD4 T cells at later time-points.
However, the amounts of HHV-6 DNA and the types of
cells harbouring HHV-6 DNA (CD4 T cells) at later time-
points cannot be fully explained by a latent infection. To
distinguish between HHV-6 reactivation and latency at
later time-points, we examined the expression of 4 HHV-
This is an open access article under the CC BY-NC license. www.medicaljournals.se/acta
Journal Compilation © 2018 Acta Dermato-Venereologica.