Acta Dermato-Venereologica issue 50:1 98-1CompleteContent | 页面 41

146 SHORT COMMUNICATION Predominant Contribution of CD4 T Cells to Human Herpesvirus 6 (HHV-6) Load in the Peripheral Blood of Patients with Drug-induced Hypersensitivity Syndrome and Persistent HHV-6 Infection Fumi MIYAGAWA, Yuki NAKAMURA, Rie OMMORI, Kazuya MIYASHITA, Hiroshi IIOKA, Natsuki MIYASHITA, Mitsuko NISHIKAWA, Yukiko HIMURO, Kohei OGAWA and Hideo ASADA* Department of Dermatology, Nara Medical University School of Medicine, 840 Shijo, Kashihara, Nara 634-8522, Japan. *E-mail: asadah@ naramed-u.ac.jp Accepted Sep 13, 2017; Epub ahead of print Sep 13, 2017 Drug-induced hypersensitivity syndrome (DIHS)/drug reaction with eosinophilia and systemic symptoms (DRESS) is a severe adverse cutaneous drug reaction associated with the reactivation of human herpesvirus 6 (HHV-6). In DIHS, HHV-6 is generally reactivated 2–3 weeks after the onset of a rash, and such reactivation is associated with the flare-up of clinical symptoms (1). The reactivation of HHV-6 usually occurs as a transient event; however, in rare cases HHV-6 DNA continues to be detected long after the onset of the condition, which is sometimes associated with frequent recurrence of clinical symptoms, such as skin rashes. There has been only one report of a case of DIHS involving a persistent HHV-6 infection (2). We report here 3 cases of DIHS in which HHV-6 DNA was detected in the patients’ peripheral blood mononuclear cells (PBMC) long after resolution of their DIHS. We also demonstrated that CD4 T cells were the main contributors to the PBMC HHV-6 DNA load throughout the patients’ clinical courses, while in the early stages of their conditions CD14 + monocytes and other types of PBMC also harboured HHV-6 DNA. PATIENTS AND METHODS The characteristics of the 3 patients with DIHS are listed in Table SI 1 . Blood samples were obtained from each patient after the onset of a rash. PBMC were isolated from whole blood by Ficoll gradient separation (GE Healthcare, Little Chalfont, UK) and divided into 2–3 aliquots. Sera were separated from whole blood by centrifugation. An aliquot of PBMC and an aliquot of serum were subjected to real-time polymerase chain reaction (PCR) to detect and quantify HHV-6 DNA. Briefly, DNA was isolated from PBMC or serum using the QIAamp DNA blood mini kit (QIAGEN, Hilden, Germany), according to the manufacturer’s protocol. Real-time PCR was performed with the TaqMan fast advanced master mix (Applied Biosystems, Foster City, CA, USA) and the following primers and probe (3): forward primer: GAAGCAGCAATCGCAACACA, probe: AACCCGTGCGCCG- CTCCC, reverse primer: ACAACATGTAACTCGGTGTACGGT. The PCR and data collection were conducted on an Applied Biosystems StepOnePlus real-time PCR system. A further aliquot of PBMC was subjected to magnetic bead purification (Miltenyi Biotec, Bergisch Gladbach, Germany) to obtain CD14 + cells. The rest of the cell fraction was subsequently used to purify the CD4 T-cell fraction. The HHV-6 DNA load of each cell type was then measured by real-time PCR. In some experiments, a further aliquot of PBMC was subjected to CD16 + cell isolation followed by CD8 T-cell isolation using magnetic beads. To detect the https://www.medicaljournals.se/acta/content/abstract/10.2340/00015555-2791 1 doi: 10.2340/00015555-2791 Acta Derm Venereol 2018; 98: 146–148 U31, U39, U90, and U94 gene transcripts, purified CD4 T cells from PBMC were cultured with 5 µg/ml phytohaemagglutinin (PHA) and 20 units/ml recombinant human interleukin 2 in GIT medium (WAKO, Tokyo, Japan). Seven days later, the cells were harvested and subjected to RNA extraction using an RNeasy plus kit (QIAGEN) followed by cDNA synthesis using a high-capacity RNA-to-cDNA kit (Applied Biosystems). Real-time PCR was carried out using specific primers and probes. RESULTS AND DISCUSSION As shown in Fig. 1A, HHV-6 DNA was detected at re- latively high copy numbers long after resolution of the patients’ DIHS, although the amounts of DNA detected at these time-points were lower than those seen during the early phase of the condition, except in case 3, in which HHV-6 DNA was detected on the day of admis- sion (day 8). Since little is known about which types of PBMC harbour HHV-6 in DIHS patients with persistent HHV- 6 infections, we next evaluated the HHV-6 DNA loads of CD4 T cells, CD14 + cells, and the remaining PBMC obtained from the 3 patients. During the early phase of the patients’ DIHS, HHV-6 DNA was detected in all cell types, with CD4 T cells being the predominant cell type. At later time-points, CD4 T cells seemed to harbour the majority of the HHV-6 DNA load (Fig. 1B). HHV-6 was found to mainly infect and replicate in CD4 T cells. However, HHV-6 is able to infect a wide variety of cell types, including natural killer cells and dendritic cells (4). In the latent state, HHV-6 is reported to persist in monocytes/macrophages (4). In some ca- ses, HHV-6 DNA could not be detected in PBMC from healthy individuals with latent HHV-6 infections (4), whereas in others low levels of HHV-6 DNA (around 2 log10 copies/ml) were detected (5, 6). In our study, no HHV-6 DNA was detected in the patients’ sera at later time-points (Fig. 1A), and while the patients’ anti-HHV-6 IgG titres increased during the early stages of their conditions they subsequently star- ted to decline (Table SI 1 ), which is not consistent with reactivation. These findings suggest that latent HHV-6 persisted in the patients’ CD4 T cells at later time-points. However, the amounts of HHV-6 DNA and the types of cells harbouring HHV-6 DNA (CD4 T cells) at later time- points cannot be fully explained by a latent infection. To distinguish between HHV-6 reactivation and latency at later time-points, we examined the expression of 4 HHV- This is an open access article under the CC BY-NC license. www.medicaljournals.se/acta Journal Compilation © 2018 Acta Dermato-Venereologica.