616
SHORT COMMUNICATION
ActaDV ActaDV
Advances in dermatology and venereology Acta Dermato-Venereologica
Simultaneous Induction of Benign Condyloma and High-grade Anal Dysplasia Induced by Low-risk Human Papillomavirus Type 42
Alexander KREUTER 1 # , Martin HUFBAUER 2 # , Steffi SILLING 2 , Frank OELLIG 3 , Baki AKGÜL 2 and Ulrike WIELAND 2
1
Department of Dermatology , Venereology and Allergology , HELIOS St Elisabeth Hospital Oberhausen , University Witten / Herdecke , Josefstr . 3 , DE-46045 Oberhausen , 2 Institute of Virology , National Reference Center for Papilloma- and Polyomaviruses , University of Cologne , and
3
Institute of Pathology , Mülheim an der Ruhr , Germany . E-mail : alexander . kreuter @ helios-kliniken . de
#
These authors contributed equally to this work . Accepted Feb 20 , 2018 ; Epub ahead of print Feb 28 , 2018
Infections with human papillomaviruses ( HPV ) induce a heterogeneous spectrum of cutaneous and mucomembraneous lesions . Epithelial lesions caused by HPV-types of the genus alpha ( e . g . anogenital warts / condylomata acuminata , intraepithelial neoplasias and invasive cancers ) predominantly occur in the anogenital region . Depending on their oncogenic potential , alpha-HPVs can be divided into high-risk ( e . g . HPV16 or HPV18 ) and low-risk types ( e . g . HPV6 or HPV11 ). In contrast to high-risk HPVs , low-risk HPVs are only rarely capable of inducing highgrade dysplasias or anogenital cancers (< 1 – 10 %) ( 1 – 3 ). We report here an immunocompetent patient with simultaneous development of benign condylomata acuminata and high-grade anal dysplasia induced by the same low-risk HPV-type , HPV42 .
CASE REPORT
A 59-year-old woman was referred to our department because of a monofocal high-grade anal intraepithelial neoplasia ( AIN grade 3 ; AIN3 ) that had been surgically removed during colonoscopy for routine colon cancer screening . The patient had no clinical and laboratory signs of immunodeficiency ( HIV testing was negative and lymphocyte subpopulations including CD3 + T-cells , CD4 + T- cells , CD8 + T-cells , CD19 + B-cells , and natural killer ( NK ) cells were within normal ranges ), no previous or current immunosuppressive medication , and no history of cervical or other HPVrelated disease . At first clinical examination with high-resolution anoscopy ( HRA ) in our department , a new lesion suspicious for HPV-related disease was surgically removed , and was again histopathologically diagnosed as AIN3 ( located at 7 o ’ clock in lithotomy position ) ( Fig . 1 ). At 2 further HRA-examinations 1 and 3 months thereafter , 2 more intra-anal lesions were surgically removed and histopathology revealed benign condyloma ( at 9 o ’ clock ) and AIN3 ( at 3 o ’ clock ), respectively . All 3 lesions had identical clinical HRA-features usually seen in benign intra-anal condyloma ( dome-shaped papules with homogenous terminal capillaries and papillary structures ), as reported previously ( 4 ). Characteristic HRA-signs of high-grade dysplasia , such as punctation , mosaicism , or neovascularization , were missing .
HPV detection and typing from these 3 lesions was performed with 3 different alpha-HPV group-specific PCRs , respectively , followed by bead-based or reverse line blot hybridization , as described previously ( 4 ). Only low-risk type HPV42 was found in the 3 biopsies , and none of the other 38 low-risk- and high-risk alpha HPV-types covered by the 3 assays were detected . HPV42 DNA load was determined by real-time PCR with type-specific primers ( fw : TGATACTGAAAATGCGCCTACAT ; rev : CATA- GAAACATTTTCCCTATTGTCTG ) and locked nucleic acid probe no . 81 ( GGCCCTGG ; Cat . no .: 04689046001 , Roche , Mannheim , Germany ) using a Light Cycler 480 ( Roche ) ( 5 ). HPV42 load was expressed as HPV42 DNA copies per betaglobin-gene copy . Viral load determination showed HPV42 DNA loads well above 1 in all 3 samples : 64.7 HPV42 DNA copies per betaglobin gene copy in the first AIN3 lesion of January 2017 ( 7 o ’ clock in lithotomy position ), 18.7 in the condyloma without dysplasia of February 2017 ( 9 o ’ clock ), and 2.0 in the AIN3 lesion of April 2017 ( 3 o ’ clock ). P16 INK4a -immunohistochemistry was performed using the CINtec histology kit ( Roche , Mannheim , Germany ) according to the manufacturer ’ s instructions , and p16 INK4a -staining , an indirect marker of HPV E7 oncogene expression , was evaluated as previously described ( 6 ). Strong p16 INK4a -positivity was found in both AIN3 lesions , whereas p16 INK4a -staining was negative in the anal condyloma ( focal p16 INK4a -staining is considered as negative ) ( Fig . 1 ).
Next , in situ hybridization was performed according to previously reported protocols ( 7 ). The hybridization probe was generated with the DIG-Nick-Translation Mix ( Roche ) using pSP64-HPV42 as template and pSP64 as negative control ( 8 ). Slides were developed with the TSA Plus Fluorescein Kit ( PerkinElmer , Waltham , MA , USA ). In accordance with the high HPV42 DNA loads measured by real-time PCR , in situ hybridization confirmed high HPV42 DNA levels , both in the AIN3 lesions and in the condyloma ( Fig . S1 1 ).
1 https :// www . medicaljournals . se / acta / content / abstract / 10.2340 / 00015555-2913
Fig . 1 . Routine histopathology and p16 INK4a -immunohistochemistry of the condyloma and of the first AIN3 lesion . ( a ) Atypical cells are present within the entire epithelium of the AIN3 lesion ( haematoxylin and eosin ( H & E ) staining ). ( b ) Classic histological features of condyloma , including hyperkeratosis , parakeratosis , and koilocytosis , are present ( H & E staining ) ( c ) “ Band-like ” p16 INK4 -positivity with both nuclear and cytoplasmatic staining within the entire lesion is present , characteristic for HPV-induced high-grade dysplasia ( p16 INK4a -immunostaining ). ( d ) Negative p16 INK4a -staining of the anal condyloma ( focal p16 INK4a -staining is considered as negative ). Original magnification × 100 .
doi : 10.2340 / 00015555-2913 Acta Derm Venereol 2018 ; 98 : 616 – 617
This is an open access article under the CC BY-NC license . www . medicaljournals . se / acta Journal Compilation © 2018 Acta Dermato-Venereologica .