Acta Dermato-Venereologica 2018, No. 6 98-6CompleteContent | Página 20

616
SHORT COMMUNICATION

ActaDV ActaDV

Advances in dermatology and venereology Acta Dermato-Venereologica
Simultaneous Induction of Benign Condyloma and High-grade Anal Dysplasia Induced by Low-risk Human Papillomavirus Type 42
Alexander KREUTER 1 #, Martin HUFBAUER 2 #, Steffi SILLING 2, Frank OELLIG 3, Baki AKGÜL 2 and Ulrike WIELAND 2
1
Department of Dermatology, Venereology and Allergology, HELIOS St Elisabeth Hospital Oberhausen, University Witten / Herdecke, Josefstr. 3, DE-46045 Oberhausen, 2 Institute of Virology, National Reference Center for Papilloma- and Polyomaviruses, University of Cologne, and
3
Institute of Pathology, Mülheim an der Ruhr, Germany. E-mail: alexander. kreuter @ helios-kliniken. de
#
These authors contributed equally to this work. Accepted Feb 20, 2018; Epub ahead of print Feb 28, 2018
Infections with human papillomaviruses( HPV) induce a heterogeneous spectrum of cutaneous and mucomembraneous lesions. Epithelial lesions caused by HPV-types of the genus alpha( e. g. anogenital warts / condylomata acuminata, intraepithelial neoplasias and invasive cancers) predominantly occur in the anogenital region. Depending on their oncogenic potential, alpha-HPVs can be divided into high-risk( e. g. HPV16 or HPV18) and low-risk types( e. g. HPV6 or HPV11). In contrast to high-risk HPVs, low-risk HPVs are only rarely capable of inducing highgrade dysplasias or anogenital cancers(< 1 – 10 %)( 1 – 3). We report here an immunocompetent patient with simultaneous development of benign condylomata acuminata and high-grade anal dysplasia induced by the same low-risk HPV-type, HPV42.
CASE REPORT
A 59-year-old woman was referred to our department because of a monofocal high-grade anal intraepithelial neoplasia( AIN grade 3; AIN3) that had been surgically removed during colonoscopy for routine colon cancer screening. The patient had no clinical and laboratory signs of immunodeficiency( HIV testing was negative and lymphocyte subpopulations including CD3 + T-cells, CD4 + T- cells, CD8 + T-cells, CD19 + B-cells, and natural killer( NK) cells were within normal ranges), no previous or current immunosuppressive medication, and no history of cervical or other HPVrelated disease. At first clinical examination with high-resolution anoscopy( HRA) in our department, a new lesion suspicious for HPV-related disease was surgically removed, and was again histopathologically diagnosed as AIN3( located at 7 o’ clock in lithotomy position)( Fig. 1). At 2 further HRA-examinations 1 and 3 months thereafter, 2 more intra-anal lesions were surgically removed and histopathology revealed benign condyloma( at 9 o’ clock) and AIN3( at 3 o’ clock), respectively. All 3 lesions had identical clinical HRA-features usually seen in benign intra-anal condyloma( dome-shaped papules with homogenous terminal capillaries and papillary structures), as reported previously( 4). Characteristic HRA-signs of high-grade dysplasia, such as punctation, mosaicism, or neovascularization, were missing.
HPV detection and typing from these 3 lesions was performed with 3 different alpha-HPV group-specific PCRs, respectively, followed by bead-based or reverse line blot hybridization, as described previously( 4). Only low-risk type HPV42 was found in the 3 biopsies, and none of the other 38 low-risk- and high-risk alpha HPV-types covered by the 3 assays were detected. HPV42 DNA load was determined by real-time PCR with type-specific primers( fw: TGATACTGAAAATGCGCCTACAT; rev: CATA- GAAACATTTTCCCTATTGTCTG) and locked nucleic acid probe no. 81( GGCCCTGG; Cat. no.: 04689046001, Roche, Mannheim, Germany) using a Light Cycler 480( Roche)( 5). HPV42 load was expressed as HPV42 DNA copies per betaglobin-gene copy. Viral load determination showed HPV42 DNA loads well above 1 in all 3 samples: 64.7 HPV42 DNA copies per betaglobin gene copy in the first AIN3 lesion of January 2017( 7 o’ clock in lithotomy position), 18.7 in the condyloma without dysplasia of February 2017( 9 o’ clock), and 2.0 in the AIN3 lesion of April 2017( 3 o’ clock). P16 INK4a-immunohistochemistry was performed using the CINtec histology kit( Roche, Mannheim, Germany) according to the manufacturer’ s instructions, and p16 INK4a-staining, an indirect marker of HPV E7 oncogene expression, was evaluated as previously described( 6). Strong p16 INK4a-positivity was found in both AIN3 lesions, whereas p16 INK4a-staining was negative in the anal condyloma( focal p16 INK4a-staining is considered as negative)( Fig. 1).
Next, in situ hybridization was performed according to previously reported protocols( 7). The hybridization probe was generated with the DIG-Nick-Translation Mix( Roche) using pSP64-HPV42 as template and pSP64 as negative control( 8). Slides were developed with the TSA Plus Fluorescein Kit( PerkinElmer, Waltham, MA, USA). In accordance with the high HPV42 DNA loads measured by real-time PCR, in situ hybridization confirmed high HPV42 DNA levels, both in the AIN3 lesions and in the condyloma( Fig. S1 1).
1 https:// www. medicaljournals. se / acta / content / abstract / 10.2340 / 00015555-2913
Fig. 1. Routine histopathology and p16 INK4a-immunohistochemistry of the condyloma and of the first AIN3 lesion.( a) Atypical cells are present within the entire epithelium of the AIN3 lesion( haematoxylin and eosin( H & E) staining).( b) Classic histological features of condyloma, including hyperkeratosis, parakeratosis, and koilocytosis, are present( H & E staining)( c)“ Band-like” p16 INK4-positivity with both nuclear and cytoplasmatic staining within the entire lesion is present, characteristic for HPV-induced high-grade dysplasia( p16 INK4a-immunostaining).( d) Negative p16 INK4a-staining of the anal condyloma( focal p16 INK4a-staining is considered as negative). Original magnification × 100.
doi: 10.2340 / 00015555-2913 Acta Derm Venereol 2018; 98: 616 – 617
This is an open access article under the CC BY-NC license. www. medicaljournals. se / acta Journal Compilation © 2018 Acta Dermato-Venereologica.